The ATP Binding Cassette Transporter Gene CgCDR1 from C.glabrata.pdf

A NTIMICROBIAL A GENTS AND C HEMOTHERAPY ,

0066-4804/99/$04.00

Nov. 1999, p. 2753–2765

Vol. 43, No. 11

The ATP Binding Cassette Transporter Gene CgCDR1 from

Candida glabrata Is Involved in the Resistance of Clinical

Isolates to Azole Antifungal Agents

DOMINIQUE SANGLARD, 1 * FRAN ¸ OISE ISCHER, 1

DAVID CALABRESE, 1

PAUL A. MAJCHERCZYK, 2

AND JACQUES BILLE 1

Institut de Microbiologie 1

and Division of Infectious Diseases, 2 Centre Hospitalier Universitaire Vaudois (CHUV),

1011 Lausanne, Switzerland

Received 17 June 1999/Returned for modiﬁcation 13 August 1999/Accepted 7 September 1999

The resistance mechanisms to azole antifungal agents were investigated in this study with two pairs of

Candida glabrata clinical isolates recovered from two separate AIDS patients. The two pairs each contained a

ﬂuconazole-susceptible isolate and a ﬂuconazole-resistant isolate, the latter with cross-resistance to itracon-

azole and ketoconazole. Since the accumulation of ﬂuconazole and of another unrelated substance, rhodamine

6G, was reduced in the azole-resistant isolates, enhanced drug efﬂux was considered as a possible resistance

mechanism. The expression of multidrug efﬂux transporter genes was therefore examined in the azole-

susceptible and azole-resistant yeast isolates. For this purpose, C. glabrata genes conferring resistance to azole

antifungals were cloned in a Saccharomyces cerevisiae strain in which the ATP binding cassette (ABC) trans-

porter gene PDR5 was deleted. Three different genes were recovered, and among them, only C. glabrata CDR1

( CgCDR1 ), a gene similar to the Candida albicans ABC transporter CDR genes, was upregulated by a factor of

5 to 8 in the azole-resistant isolates. A correlation between upregulation of this gene and azole resistance was

thus established. The deletion of CgCDR1 in an azole-resistant C. glabrata clinical isolate rendered the resulting

mutant (DSY1041) susceptible to azole derivatives as the azole-susceptible clinical parent, thus providing

genetic evidence that a speciﬁc mechanism was involved in the azole resistance of a clinical isolate. When

CgCDR1 obtained from an azole-susceptible isolate was reintroduced with the help of a centromeric vector in

DSY1041, azole resistance was restored and thus suggested that a trans -acting mutation(s) could be made

responsible for the increased expression of this ABC transporter gene in the azole-resistant strain. This study

demonstrates for the ﬁrst time the determinant role of an ABC transporter gene in the acquisition of resistance

to azole antifungals by C. glabrata clinical isolates.

Patients with advanced human immunodeﬁciency virus in-

fection develop opportunistic infections due to the decrease in

their immunity. Oropharyngeal candidiasis (OPC) caused by

Candida albicans is a very common opportunistic infection in

these patients and is treated mainly with azole antifungal

agents, particularly with ﬂuconazole. Treatment failures have

been observed following the repeated use of this agent in

relapses of OPC (21, 37, 45, 55). Different laboratories have

reported that C. albicans isolates sampled sequentially during

ﬂuconazole treatment showed decreased susceptibility to ﬂu-

conazole compared to that of the isolates sampled at the time

of the ﬁrst episode of infection (6, 30, 41, 53). Clinical resistance

to ﬂuconazole has been correlated with in vitro resistance of

the yeasts recovered from patients undergoing antifungal ther-

apy (54). This phenomenon has been also documented in other

yeast species, including Candida glabrata (4, 16), Candida tropi-

calis (28), and Candida krusei (57, 58), and in Cryptococcus

neoformans (27).

The increasing number of azole-resistant isolates recovered

in many institutions during the past decade has motivated

studies with the aim of understanding their mechanisms of

resistance at the molecular level. Until now, C. albicans isolates

have provided a major source for the discovery of mechanisms

of azole resistance. Recent ﬁndings have shown that increased

azole efﬂux is an important mechanism of resistance in yeast

clinical isolates. In azole-resistant C. albicans isolates, in-

creased azole efﬂux has been correlated with the upregulation

of multidrug efﬂux transporter genes from two distinct families,

the ATP binding cassette (ABC) transporters ( CDR1 and

CDR2 ) and the major facilitators ( C. albicans MDR1 ) (3, 27,

30, 50, 53, 60). Deletion of CDR1 in C. albicans leads to azole

hypersusceptibility and increased ﬂuconazole accumulation

(51). Decrease in azole afﬁnity of the target enzyme of these

antifungals, i.e., the cytochrome P450 lanosterol demethylase

(called CYP51A1, or ERG11), has also been explained at the

molecular level. Mutations in the genes encoding CYP51A1

( CYP51A1 ) have been detected in azole-resistant yeasts. These

mutations resulted, in some cases, in amino acid substitutions

with the probable effect of altering the binding properties of

azoles and thus contributing to a decrease in azole susceptibil-

ity in clinical yeast isolates (49). Another mechanism of azole

resistance originates from alterations in the ergosterol biosyn-

thesis pathway, often resulting in the absence of ergosterol.

This feature renders cells affected by this mechanism cross-

resistant to amphotericin B. A few C. albicans clinical isolates

possess this property and have been found to accumulate 14

methylergosta-8,24(28)-dien-3

-diol, which is indicative of

5,6 sterol desaturase (24, 35). The above-men-

tioned resistance mechanisms can combine with each other in

C. albicans and complicate the analysis of such isolates, since it

is difﬁcult to establish the role of an individual mechanism in

the decrease in azole susceptibility (48). Dissection of resis-

tance mechanisms by the use of genetics in C. albicans clinical

* Corresponding author. Mailing address: Institute of Microbiology,

University Hospital Lausanne (CHUV), Rue de Bugnon 44, CH-1011

Lausanne, Switzerland. Phone: 0041 21 3144083. Fax: 0041 21 3144060.

E-mail: Dominique.Sanglard@chuv.hospvd.ch.

2753

a defect in

2754

SANGLARD ET AL.

A NTIMICROB .A GENTS C HEMOTHER .

TABLE 1. Yeast strains used in this study

Strain

Genotype

Reference

S. cerevisiae

YKKB-13

MAT a ura3-52 lys2-801 (Am) ade2-101 (Oc) trp1-

63 his3-

200 leu2-

pdr5::TRP1

C. glabrata

ATCC 90030

ATCC reference strain

DSY528

Clinical isolate, azole susceptible from patient 1

This study

DSY530

Clinical isolate, azole resistant from patient 1

This study

DSY562

Clinical isolate, azole susceptible from patient 2

This study

DSY565

Clinical isolate, azole resistant from patient 2

This study

DSY1029

ura3 derivative of DSY565

This study

DSY1041

cgcdr1::hisG-URA3-hisG , derived from DSY1029

This study

DSY1056

cgcdr1::hisG , derived from DSY1041

This study

DSY671

ura3

DSY1033

cgcdr1::hisG-URA3-hisG , derived from DSY671

This study

DSY1067

cgcdr1::hisG , derived from DSY1033

This study

DSY1717

DSY1041 transformed with pDS670

This study

DSY1718

DSY1033 transformed with pDS670

This study

isolates resistant to azole antifungal agents has not been re-

ported yet. This lack of important information arises from the

difﬁculties of developing reliable genetic systems for this dip-

loid organism.

Historically, C. albicans accounted for 70 to 80% of organ-

isms isolated in patients infected by fungal species. However,

recent data report a population shift toward non- C. albicans

yeast species, such as C. glabrata , C. tropicalis ,or C. krusei (15).

Among the non- C. albicans species, C. glabrata has emerged as

an important nosocomial pathogen. Berrouane et al. (7) re-

ported that among Candida species, the proportion of C. gla-

brata infections in the Iowa University Hospitals from 1988 to

1994 increased signiﬁcantly, while it remained unchanged for

other yeast species and even decreased for C. albicans . Other

investigators have noted similar increases in the frequency of

infections caused by C. glabrata , mostly in conjunction with the

use of azoles (34, 39, 40). We also observed that C. glabrata was

often recovered from cultures originating from AIDS patients

with OPC. C. glabrata is known to be less susceptible to ﬂu-

conazole than most of the C. albicans ﬂuconazole-susceptible

isolates. Rex et al. (43) reported that the minimal inhibitory

concentration inhibiting 50% of the yeast population investi-

gated (MIC 50 ) of ﬂuconazole for 31 C. glabrata isolates was 16

MATERIALS AND METHODS

Strains and media. The yeast strains used in this study are listed in Table 1.

They were grown at 30°C on yeast extract-peptone-dextrose (YEPD) complex

medium containing 2% glucose, 1% Bacto peptone (Difco Laboratories, Detroit,

Mich.), and 0.5% yeast extract (Difco). YEPD agar plates contained 2% agar

(Difco) as a supplement. Yeast nitrogen base (YNB [Difco]) with 2% glucose

and 2% agar (Difco) with appropriate amino acids and bases was used as a

selective medium after transformation of S. cerevisiae YKKB-13 and C. glabrata .

Agar plates containing 50

(19) was used as a host for plasmid

constructions and propagation and was grown on standard media.

Fluconazole and rhodamine 6G accumulation. Fluconazole accumulation test-

ing was performed in duplicate with 3 H-labelled ﬂuconazole (Amersham Life

Science, Little Chalfont, Buckinghamshire, United Kingdom) as described pre-

viously (53), but with a single incubation time of 20 min. Rhodamine 6G (Sigma,

Fluka Chemie AG, Buchs, Switzerland) accumulation testing was performed

with yeast cells grown to the logarithmic phase in 14 ml of sterile polystyrene

tubes with 2 ml of YEPD at 30°C under constant agitation. Rhodamine 6G

labelling of cells was performed in 1 ml of YEPD with 10 7

cells and containing

M rhodamine 6G. The mixture was incubated for 30 min at 30°C, after which

it was stopped by placing the tubes on ice. These conditions have been optimized

for minimal incubation time and maximal rhodamine 6G accumulation (data not

shown). The reaction mixture was then diluted 40-fold in cold sterile 0.1 M

phosphate-buffered saline (PBS) at pH 7.0 and then directly subjected to ﬂow

cytometry in a FACScan ﬂuorescence-activated cell sorter (FACS) (Becton

Dickinson, San Jose, Calif.). Fluorescence was measured at an excitation wave-

length of 488 nm and an emission wavelength of 515 nm (F1 detector). The

sheath ﬂuid was Isotone II. Data were acquired for 1,500 cells with the FACScan

Lysis II software. Rhodamine 6G efﬂux was determined with 10 7 cells previously

loaded by incubation with 10

g/ml for 129 C. albicans

isolates. In several patients who responded poorly to ﬂucon-

azole therapy, we noticed that C. glabrata isolates could persist

and that their susceptibility to azoles was decreased. Since

mechanisms of resistance to azoles have been less intensively

investigated in non- C. albicans species such as C. glabrata ,we

addressed here the molecular basis of resistance in two pairs of

isolates taken from two different AIDS patients with docu-

mented azole antifungal treatment failure. We ﬁrst isolated C.

glabrata azole resistance genes by complementation of hyper-

susceptibility of a Saccharomyces cerevisiae ABC transporter

mutant. From the three different azole resistance genes iso-

lated, only CgCDR1 , which resembles the C. albicans ABC

transporter CDR genes, was upregulated in the azole-resistant

C. glabrata isolates from these two patients. By introducing a

genetic marker in an azole-resistant clinical isolate, not only

could evidence for the participation of this gene in azole re-

sistance be obtained, but the nature of the mutation or muta-

tions implicated in the upregulation of CgCDR1 could be pre-

dicted.

M rhodamine 6G at 30°C in YEPD. Cells were

washed three times with YEPD medium at 4°C to remove excess rhodamine 6G,

and efﬂux was started by incubation at 30°C in the same medium. The decrease

in ﬂuorescence of loaded cells was then recorded at regular time intervals.

Drug susceptibility tests. Tests of susceptibility to azole antifungals were

performed by broth microdilution assay according to the National Committee for

Clinical Laboratory Standards (NCCLS) protocol M27-A (33) with RPMI-1640

medium (Difco) and incubation at 35°C for 48 h. Endpoint readings were re-

corded with a microplate reader (Bio-Rad, Hercules, Calif.), and the azole

concentration yielding at least 50% growth inhibition compared to the growth in

drug-free medium was deﬁned as the MIC. Amphotericin B susceptibility was

measured according to growth in Antibiotic Medium 3 broth (Difco) as recom-

mended previously (42).

Susceptibility to different compounds of the C. glabrata isolates and of S.

cerevisiae strains containing C. glabrata drug resistance genes was also tested

qualitatively by spotting serial dilutions of yeast cultures onto complex YEPD

medium agar plates. This provides an easy visualization of growth differences

between different yeast strains. Since S. cerevisiae does not grow well in the

RPMI medium described in the NCCLS protocol M27-A, the use of the quali-

tative plate assay for drug susceptibility is more adequate. The following drugs

were solubilized in dimethyl sulfoxide: ketoconazole and itraconazole (Janssen

Pharmaceuticals, Beerse, Belgium), 4-nitroquinoline- N -oxide (Sigma), and

benomyl (Riedel-de-Ha¨n, Seelze, Germany). Fluconazole (Pﬁzer UK, Sand-

g of 5-ﬂuoroorotic acid (5-FOA) per ml were made

for the introduction of the ura3 genetic marker in YNB selective medium with 50

g of uridine per ml. Escherichia coli DH5

g/ml, while the MIC 50 was 0.25

V OL . 43, 1999

AZOLE RESISTANCE IN C. GLABRATA

2755

TABLE 2. Antifungal drug susceptibility of C. glabrata isolates taken from two AIDS patients with OPC

MIC (

g/ml)

Time elapsed between

samplings (days)

Isolate

Fluconazole

Ketoconazole

Itraconazole

Amphotericin B

DSY528

0.062

0.125

0.5

DSY530

0.5

DSY562

0.031

0.125

0.5

DSY565

128

0.5

wich, United Kingdom), cycloheximide, ﬂuphenazine, and crystal violet (Sigma)

were dissolved in water. Each plate contained 15 ml of agar. The drugs were

diluted in the corresponding solvents to achieve the concentrations used in

YEPD plates. Preliminary tests were performed to optimize drug concentrations

in YEPD plates so that growth differences between the different S. cerevisiae and

C. glabrata strains used in this study could be observed. To perform the suscep-

tibility tests, yeasts were grown overnight at 30°C with constant shaking in YEPD

liquid medium. The cultures were diluted to 2

80°C.

Typing of C. glabrata clinical isolates. Two different methods were utilized for

the typing analysis of the C. glabrata clinical isolates. The ﬁrst method was based

on restriction fragment length polymorphism (RFLP) with Hin fI as restriction

enzyme as described by others (5, 11). The second method was based on the use

of repetitive probes Cg6 and Cg12 as described previously (29). In this method,

10 7 cells per ml in 0.9% NaCl.

Five microliters of this suspension and of serial dilutions of each yeast culture

was spotted onto each type of plate and incubated for 48 h at 30°C.

Ergosterol biosynthesis inhibition. Ergosterol biosynthesis inhibition assays

were performed with cellular extracts from C. glabrata strains. Cellular extracts

were from cells grown in 50 ml of YEPD medium and were obtained by me-

chanical disruption with glass beads (0.3 to 0.5 mm in diameter) in phosphate

buffer (0.1 M sodium phosphate [pH 7.5]). The extracts were centrifuged at

10,000

gof C. glabrata genomic DNA, prepared as described above, was cut with

Eco RI. The digested DNA was electrophoresed in a 0.7% agarose gel. Transfer

was made by vacuum blotting on GeneScreen Plus membranes (DuPont NEN,

Boston, Mass.) after depurination of the DNA with HCl. The Cg6 and Cg12

repetitive probes were prepared from

phage DNA by liquid lysate with the

kit (Qiagen, Chatsworth, Calif.). The probes were labelled with

[ 32 P]dATP by nick translation with a nick translation system (Gibco BRL, Life

Technologies, Inc., Rockville, Md.). After prehybridization for 30 min, mem-

branes were hybridized overnight at 65°C in 5

g for 10 min at 4°C. The assays were performed with increasing

ﬂuconazole concentrations by the method described by Vanden Bossche et al.

(56). Each assay mixture contained 5 mg of cellular proteins from the individual

strain which was measured by the Bradford assay (Bio-Rad, Hercules, Calif.).

Isolation of DNA and RNA. The small-scale isolation of DNA and RNA from

C. glabrata was performed from cultures grown to the logarithmic growth phase

in YEPD medium at 30°C under constant shaking. One milliliter of each culture

was centrifuged in Eppendorf tubes at 4°C. After a washing step with TE (10 mM

Tris-HCl [pH 7.5], 1 mM EDTA), yeast DNA was extracted by adding 0.3 g of

glass beads (0.3 to 0.5 mm in diameter), 200

SSPE is 0.15 M NaCl

with 10 mM NaH 2 PO 4 and 1 mM EDTA) containing 5% dextran sulfate and

0.3% SDS. The membranes were washed four times for 30 min each at 48°C in

SSPE (1

SSPE containing 0.2% SDS. Fuji RX ﬁlm was used for visualization of

hybridization patterns.

Yeast transformations. S. cerevisiae and C. glabrata were transformed by the

lithium acetate procedure as described by Sanglard et al. (51).

Cloning of C. glabrata azole resistance genes. The C. glabrata gene library was

constructed in the plasmid YEp24 (GenBank accession no. L09156). C. glabrata

genomic DNA from strain ATCC 90030 was partially digested with Sau 3A to

obtain fragment lengths ranging from 6 to 9 kb. The fragments were puriﬁed by

agarose gel electrophoresis and ligated to YEp24 previously digested with

Bam HI. The gene library was ampliﬁed in E. coli DH5

l of a breaking buffer (2% Triton

X-100, 1% sodium dodecyl sulfate [SDS], 10 mM Tris-HCl [pH 8.0], 1 mM

EDTA, 100 mM NaCl), and 200

l of phenol-chloroform-isoamyl alcohol (24:

24:1). After 1 min of vortexing in a Mini-Beadbeater (Biospec Products, Inc.,

Bartlesville, Okla.), the tubes were centrifuged at maximum speed for 10 min in

a microcentrifuge, and the supernatant was reextracted with chloroform-isoamyl

alcohol (24:1). Nucleic acids were then precipitated with 20

. C. glabrata genes

conferring resistance to azole antifungals were cloned by complementation of

hypersusceptibility to ﬂuconazole of the S. cerevisiae strain YKKB-13. First,

about 80,000 Ura 1 clones were selected after transformation of YKKB-13 with

the C. glabrata genomic library. The Ura 1 clones were then pooled in separate

aliquots, part of which were spotted onto YEPD medium containing 5 and 10

l of 3 M sodium

acetate (pH 5.0) and 400

l of ethanol at

20°C, washed with 70% ethanol, and

l of TE. For the extraction of RNA, the yeast cell pellet was

mixed with 0.3 g of glass beads, 300

l of RNA extraction buffer (0.1 M Tris-HCl

[pH 7.5], 0.1 M LiCl, 10 mM EDTA, 0.5% SDS) and 300

80°C.

Plasmid rescue from S. cerevisiae. Episomal plasmids from the parent vector

YEp24 were rescued from S. cerevisiae transformants by electroporation in E.

coli . Yeast cells were grown in selective YNB medium to late log phase, and total

DNA was extracted as outlined above. One microliter of the DNA suspension

(50

l of phenol-chloro-

form-isoamyl alcohol (24:24:1). After 1 min of vortexing in the Mini-Beadbeater,

the aqueous phase was reextracted with phenol-chloroform-isoamyl alcohol, and

RNA was precipitated with 600

l of ethanol at

20°C for 1 h. The RNA pellet

was resuspended in 50

l of diethyl pyrocarbonate-treated H 2 O, and the con-

, and ampicillin-resistant clones

from each transformant were analyzed by restriction enzyme analysis.

Construction of C. glabrata vectors. To enable the replication of YEp24-

derived plasmids in C. glabrata and particularly of pNB126, the CgCEN and

CgARS sequences contained in pCgACU-5 were subcloned in these vectors.

pCgACU-5 (a kind gift of K. Kitada) was generated by inserting CgURA3 into

the Xho I site of pCgAC-5 (25). The presence of the CgCEN and CgARS se-

quences in plasmids contributes to their stable replication in C. glabrata in one

copy per cell. The CgCEN and CgARS sequences were recovered from

pCgACU-5 by digestion with Sal I and Xho I and subcloned into the single Sal I site

l) was electroporated into E. coli DH5

TABLE 3. Fluconazole accumulation and inhibition of ergosterol

biosynthesis by ﬂuconazole in C. glabrata isolates

Isolate

Amt of

[ 3 H]ﬂuconazole/2

IC 50 of ﬂuconazole for ergosterol

biosynthesis (nM)

10 7

cells (cpm)

DSY528

300

DSY530

FIG. 1. Typing of C. glabrata clinical isolates used in this study. (A) Restric-

tion enzyme analysis of C. glabrata genomic DNA digested with Hin fI. Restric-

tion fragments were separated by 1% agarose gel electrophoresis and stained

with ethidium bromide. (B) Proﬁles of band patterns revealed by hybridization

with the repetitive element probes Cg6 and Cg12 as described by Lockhart et al.

(29). Molecular size standards were depicted on each photograph.

DSY562

313

DSY565

DSY1041

457

ND a

a ND, not determined.

centration was measured spectrophotometrically at A 260 and A 280 . RNA was

stored at

Qiagen

resuspended in 50

of ﬂuconazole per ml, while the remaining cells were kept frozen at

2756

SANGLARD ET AL.

A NTIMICROB .A GENTS C HEMOTHER .

DNA sequencing. Sequence data were obtained with DNA fragments sub-

cloned from pNB124, pNB125, and pNB126 into pBluescript (Stratagene GmbH,

Z¨rich, Switzerland). Sequence data were generated on both DNA strands by

using reverse or universal primers and customized primers by automated se-

quencing in a Li-Cor 4200 sequencer (Li-Cor, Inc., Lincoln, Nebr.).

FIG. 2. Rhodamine 6G accumulation in C. glabrata clinical isolates. Cells

were labelled with rhodamine 6G and analyzed by FACS as indicated in Mate-

rials and Methods. FACS histograms are given for the unlabelled control

(DSY562) and for each yeast strain labelled with rhodamine 6G. The mean

ﬂuorescence values for DSY562 and DSY565 were 691 and 113, respectively, and

those for DSY528 and DSY530 were 566 and 110, respectively. Accumulation

experiments with rhodamine 6G were repeated ﬁve times with these strains.

DSY565 and DSY530 mean ﬂuorescence reached 16%

1.8% and 12%

RESULTS

Origin and azole susceptibility of C. glabrata isolates. For

the study of mechanisms of resistance to azoles, C. glabrata

clinical isolates were selected retrospectively from a collection

of yeasts recovered from AIDS patients with OPC. The C.

glabrata strains were chosen from two different patients with

recurrent OPC and were ﬁrst selected on the basis of de-

creased susceptibility to azole antifungals.

Patient 1 had his ﬁrst OPC episode in October 1990 and was

diagnosed with AIDS. C. albicans was isolated initially from

the patient’s oral cavity in December 1993 and was subse-

quently found in recurrent episodes of OPC. In April 1994, the

ﬁrst C. glabrata strain (DSY528) was isolated. At that time,

patient 1 had received a cumulative dose of 17.3 g of ﬂucon-

azole, and his CD4 count in blood was 4 cells per mm 3 . After

treatment with 400 mg of ﬂuconazole for 7 consecutive days,

OPC was still persistent 47 days later. DSY530 was isolated at

this time and showed a reduced susceptibility to ﬂuconazole

compared to DSY528 (Table 2). Patient 2 had his ﬁrst clinically

documented episode of OPC in November 1991 and was di-

agnosed with AIDS. C. albicans was ﬁrst isolated from the oral

cavity in February 1993. In May 1995, C. glabrata DSY562 was

isolated for the ﬁrst time together with C. albicans . The patient

had received a cumulative dose of 4.1 g of ﬂuconazole, and his

CD4 count in blood was 34 cells per mm 3 . After two courses of

treatment with 200 mg of ﬂuconazole for 7 consecutive days

each, OPC was still persistent 50 days later, and the C. glabrata

strain DSY565 was isolated, which showed reduced suscepti-

bility to ﬂuconazole compared to that of DSY562 (Table 2). In

both patients, C. glabrata isolates were isolated in mixed cul-

ture with C. albicans . The less susceptible C. glabrata isolate of

each patient will be designated in this study as azole resistant,

without reference to the clinical MIC breakpoints proposed by

Rex et al. (44).

The C. glabrata strains from these two patients were typed by

two different methods. The results shown in Fig. 1 demonstrate

that identical banding patterns for the two C. glabrata strains

from a given patient could be obtained by these methods and

thus suggest that the azole-susceptible and azole-resistant iso-

lates from these two patients were related to each other. This

implies that no strain replacement occurred during azole ther-

apy in these patients, but rather that azole resistance devel-

oped from the original azole-susceptible isolates. The stability

of the resistance phenotype did not change after more than 50

consecutive passages (over 500 generations) in drug-free me-

dium. Thus, azole resistance in the azole-resistant isolates

could be due to genome alterations rather than to transient

adaptation to azole antifungals.

Fluconazole and rhodamine 6G accumulations in C. glabrata

isolates. We performed several experiments in order to deter-

mine the mechanisms of azole resistance in the azole-resistant

isolates. First, no changes in amphotericin B susceptibility were

observed in the four clinical strains used in this study (Table 2).

Therefore, since some alterations in the ergosterol biosynthetic

pathway are coupled with amphotericin B resistance (17, 35), it

is likely that no alterations in this pathway were occurring in

these strains. In agreement with this hypothesis was the detec-

tion of this sterol in ergosterol biosynthesis inhibition assays.

Second, ﬂuconazole concentrations at which the ergosterol

biosynthesis was inhibited in cellular extracts by 50% (IC 50 ) did

of the values obtained with DSY562 and DSY528, respectively.

of pNB126 to generate pDS670. pDS670 contains CgCDR1 and could transform

successfully ura3 mutants from both S. cerevisiae and C. glabrata .

Disruption of CgCDR1. For the disruption of CgCDR1 in C. glabrata , a 4.9-kb

fragment from pNB126 was cloned into the same sites of pMTL21 (10), yielding

pDS458. An 800-bp fragment was removed from pDS458 by digestion with Bgl II,

thus creating a deletion in CgCDR1. The 3.7-kb Bam HI- Bgl II fragment from

pNKY51, which contained a hisG-URA3-hisG cassette with the S. cerevisiae

URA3 gene, was inserted in the Bgl II-treated pDS458, thus yielding pDS460.

Digestion of pDS460 with Pvu II and Xho I, the latter cutting in the polylinker site

of pMTL21, generated a fragment of 5.3 kb which was used to transform

DSY1029 by lithium acetate.

Northern and Southern blots. DNA was separated by conventional 1% aga-

rose gel electrophoresis in TAE buffer (40 mM Tris-acetate [pH 7.5], 1 mM

EDTA). For RNA electrophoresis, RNA samples were resuspended in a loading

buffer (50% formamide, 100 mM morpholinepropanesulfonic acid [MOPS] [pH

7.0], 6.4% formaldehyde, 5% glycerol, 5% of a water solution saturated with

bromophenol blue), denatured at 85°C for 5 min, and separated by 1% agarose

gel electrophoresis. The agarose was melted in a buffer containing 0.1 M MOPS,

0.6 M formaldehyde, and 10

SSC (1

SSC

gof

salmon sperm DNA per ml. 32 P-DNA-labelled probes were generated by random

priming (14) and added to the hybridization solution overnight. Washing steps

were performed at high stringency identical to those recommended by the sup-

plier (DuPont NEN, Boston, Mass.). Stripping of probes off Northern blots for

sequential hybridizations was achieved by boiling the membranes for 10 min in

TE buffer with 0.1% SDS.

The DNA probes used in Southern and Northern blots were as follows:

CgCDR1 , 1.8-kb Xba I- Bam HI fragment from pNB126; CgYAP1 , 2.3-kb Pst I- Nru I

fragment from pNB125; and CgMDR1 , 1.2-kb Eco RV fragment from pNB124.

The CgERG11 and CgURA3 probes were generated from fragments ampliﬁed by

PCR from genomic DNA. The primers for CgURA3 (GenBank accession no.

L13661) were 5

CTCGAGAACCAATTGCATCA 3

and 5

CTAGCTTCCTA

and ampliﬁed a 900-bp fragment. The primers for CgERG11

(GenBank accession no. L40389) were 5

ATGTCCACTGAAAACACTTCT

TTG 3

and 5

CTAGTACTTTTGTTCTGGATGTCT 3

and ampliﬁed the

1.6-kb CgERG11 open reading frame (ORF).

Quantiﬁcations of Northern blot bands were performed by scanning the hy-

bridized membranes in an Instant Imager (Packard Instrument Company, Me-

riden, Conn.). Signals were integrated by the software supplied by the manufac-

turer and normalized to the corresponding values of an internal standard. In the

case of C. glabrata , the internal standard was the CgURA3 probe.

g of ethidium bromide per ml. The electrophoresis

buffer was 0.1 M MOPS (pH 7.0). After completion of electrophoresis, RNA was

visualized under UV light, and the position of the rRNA was determined. Both

Northern and Southern blots were performed by vacuum blotting onto Gene-

Screen Plus membranes (DuPont NEN, Boston, Mass.). Membranes containing

RNA were baked under vacuum for2hat80°C. Membranes were prehybridized

at 42°C with a buffer consisting of 50% formamide, 1% SDS, 4

is 0.15 M NaCl plus 0.015 M sodium citrate), 10% dextran sulfate, and 100

TTGGATATG 3

V OL . 43, 1999

AZOLE RESISTANCE IN C. GLABRATA

2757

pdr5 mutant YKKB-13. The plasmid backbone is YEp24. Sau 3A-digested C. glabrata DNA was introduced at the Bam HI site of

YEp24 in the construction of the gene library. The transcription directions of the ORF of each azole resistance gene deduced from nucleotide sequencing are shown

by arrows. Ba, Bam HI; Bg, Bgl II; E, Eco RI; Ev, Eco RV; Xba, Xba I; [Ba/Sa], Bam HI site of YEp24 destroyed by insertion of a genomic Sau 3A site. (B) Drug resistance

proﬁles of S. cerevisiae YKKB-13 transformed with plasmids pNB124, pNB125, and pNB126. Yeast strains were spotted in serial dilutions onto YEPD medium

containing the drug at the indicated concentration. Plates were incubated at 30°C for 48 h.

not vary signiﬁcantly between azole-susceptible and azole-re-

sistant isolates (Table 3). This led us to deduce that an alter-

ation in the afﬁnity of the C. glabrata CYP51A1 proteins to

azoles was not the cause of azole resistance in these isolates.

We therefore tested the accumulation of two different sub-

stances in the azole-susceptible and azole-resistant isolates. As

shown in Table 3, the azole-resistant isolates were accumulat-

ing less ﬂuconazole than their azole-susceptible parents. The

accumulation of ﬂuconazole was reduced by factors of 3.8 and

3.1 in DSY565 and DSY530 compared to those in DSY562 and

DSY528, respectively. Failure in drug accumulation was not

restricted to a single compound, since intracellular levels of

rhodamine 6G were also affected in the azole-resistant isolates

(Fig. 2). The decreases in rhodamine 6G accumulation were

6.1- and 5.1-fold in DSY565 and DSY530 compared to those in

DSY562 and DSY528, respectively. Failure in accumulating

several unrelated drugs in the azole-resistant isolates was rem-

iniscent of the effect of multidrug efﬂux transporters observed

in C. albicans , and therefore we exploited the possibility that

multidrug efﬂux transporter genes were upregulated in the

azole-resistant C. glabrata isolates.

Cloning of C. glabrata azole resistance genes. Given the

observations mentioned above, we ﬁrst attempted to isolate

multidrug efﬂux transporter genes from C. glabrata , since at the

time these studies were initiated, no C. glabrata gene encoding

a transporter was available. We used a strategy consisting of

isolation of C. glabrata genes which could confer azole resis-

tance to an S. cerevisiae multidrug efﬂux transporter mutant.

Since the absence of ABC transporter Pdr5p in S. cerevisiae

yields hypersusceptibility to azole antifungals, this genetic

background was suitable to isolate genes involved in azole

resistance in C. glabrata . From a total of about 80,000 Ura 1 S.

cerevisiae transformants, more than 200 individual yeasts able

to grow on media containing 5 and 10

g of ﬂuconazole per ml, 0.1 and 1

gof

itraconazole per ml, 0.2 and 2

g of ketoconazole per ml, 0.25

g of cycloheximide per ml, 10

g of ﬂuphenazine per ml, 50

g of benomyl per ml, 0.5

g of crystal violet per ml, and 0.5

g of nitroquinoline- N -oxide per ml. Among the 200 ﬂucon-

azole-resistant clones, only 20 were speciﬁcally resistant to

ﬂuconazole among the azole drugs tested while remaining re-

sistant to cycloheximide, benomyl, and nitroquinoline- N -oxide.

The other yeast transformants were able to grow on medium

containing different azole antifungals and other drugs, such as

cycloheximide and ﬂuphenazine. Plasmids rescued from these

isolates were extracted and separated by gel electrophoresis.

FIG. 3. Cloning of azole resistance genes in C. glabrata . (A) Restriction maps of C. glabrata insert DNA from plasmids pNB124, pNB125, and pNB126 conferring

azole resistance in the S. cerevisiae

g of ﬂuconazole per ml

were selected. Each ﬂuconazole-resistant clone was then tested

for different drug resistance proﬁles by using agar plates con-

taining 10 and 25

Plik z chomika:

Inne pliki z tego folderu:

Inne foldery tego chomika: